IB Biology HL Topic 7: Nucleic Acids

• Explaining bonding in the tertiary and quaternary structures of polypeptides

  Ionic bonds can form between positively and negatively charged R groups (acidic amino acids have R groups that can lose a H+ ion and become negatively charged and basic amino acids have R groups that can accept a H+ ion and become positively charged

  Hydrophobic interactions (weak bonds) can form between R groups that re non-polar

  Hydrogen bonds can form between some R groups

  Disulphide bridges (strong covalent bonds) can form between pairs of cysteines
• Explain the quaternary structure of polypeptides

  Quaternary structure is the linking of two or more polypeptides to form a single protein.
• Explain the tertiary structure of polypeptides


  Tertiary structure is the 3rd dimension conformation of a polypeptide. The conformation is stabilized by intramolecular bonds between R-groups on the amino acid.
• Explain the secondary structure of polypeptides

  Polypeptides have a main chain of N and C atoms covalently bonded together (eg. N-C-C-N-N-C). Each N has a H bonded to it. Every second C has a O double bonded to it. Hydrogen bonds can form between the N-H and C=O groups if they are brought close together. If sections of polypeptide run parallel beta-pleated sheets can form. If the polypeptide is wound into a right-handed helix alpha-helix structures can develop.

  
• Explain the primary structure of polypeptides

  Just the number and sequence of amino acids in a polypeptide
• Explain the process of termination of translation

  1. The ribosome moves along the mRNA in a 5' to 3' direction translating each codon until it reaches a stop codon

  2. No tRNA is complimentary to stop codon, instead release factors bind to the A site, causing the release of the polypeptide from the tRNA in the P site

  3. The tRNA detaches from the P site and the mRNA detaches from the small sub-unit.

  4. The large and small sub-units of the ribosome separate
• Explain the process of translation elongation (middle of translation)

  1. The ribosome moves three bases along the mRNA towards the 3' end. This moves the tRNA in the P site to the E site and the tRNA carrying the growing polypeptide from the A to the P site so the A site becomes vacant

  2. the tRNA in the E site detaches

  3. A complimentary tRNA binds to the next codon on the mRNA in the A site

  4. The growing polypeptide attached to the tRNA in the P site is linked to the amino acid on the tRNA in the A site by forming a polypeptide bond
• How is translation initiated?

  1. the small sub-unit of the ribosome binds to the mRNA at the start codon

  2. A tRNA with an anti-codon complementary to the start codon binds. It carries the amino acid methionine

  3. The large sub-unit of ribosome binds to the small sub-unit, positioning the methionine in the P site

  4. The next complimentary tRNA binds to the A site

  5. A peptide bond forms between the amino acids held in the P and A sites
• What are bound ribosomes?

  Ribosomes attached to the membranes of the endoplasmic reticulum that synthesize proteins for secretion form the cell or for use in lysosomes
• What are free ribosomes?

  Ribosomes in the cytoplasm that synthesize proteins primarily for use within the cell
• Explain the structure of ribosomes.

  Proteins and ribosomal RNA molecules both form part of the structure

  There are two sub-units, one large one small

  There is a binding site for mRNA on the small sub-unit

  There are three binding sites for tRNA on the large sub-unit

  A site for tRNA to bring an (A)mino acid

  P site for tRNA carrying the growing (P)olypeptide

  E site for the tRNA to (E)xit the ribosome

  
• What energy is needed to attach amino acids to tRNA?

  Energy from ATP is needed. ATP and the appropriate amino acid bind and tRNA bind to the active site of the activating enzyme. Phosphate pair is released from ATP and remaining AMP bonds to the amino acid giving energy. This energy is used to allow the amino acid to bind to the tRNA
• Explain the chemical makeup of transfer RNA

  Double stranded sections with base paring

  Triplet of bases called anticodons in a loop of 7 bases, plus two other loops of bases

  Base sequence CCA at 3' terminal which forms a site for attaching an amino acid

  There are 20 different tRNA for 20 different amino acids

  
• What is post-transcriptional modification?

  The modification of mRNA after transcription. It happens before mRNA leaves the nucleus. Introns (pieces of non-coding DNA) are removed leaving only exons that splice together to form mature mRNA

  
• What is methylation?

  It is a form of epigenetics. Cytosine in DNA can be converted to methylcitosine by adding a methyl group (-CH3). This can only happen when there is a guanine on the 3' side of cytosine. It is a method of gene expression.
• What is the epigenome?

  It is the pattern of chemical markers establish in the DNA of a cell during life. They are attached to the DNA to fix the pattern of gene expression. The markers are usually passed down only to daughter cells from mitosis, but are sometimes passed to gametes in meiosis, making them hereditable.
• What is Lamarckism?

  The idea that acquired characteristics can be inherited
• What is a polysome and how can it be identified.

  They are groups of ribosomes moving along the same mRNA as they simultaneously translate it. They look like lots of dots clustering around a line

  
• What are gene promoters, what do they do and how do they do it?

  Gene promoters are sequences of non-coding DNA, each gene has one. Gene promoters control gene expression in the transcription stage.

  IN EUKARYOTES: Proteins called transcription factors bind to the promoter allowing RNA polymerase to bind and start transcription. Several transcription factors are needed and some can be activated by the binding of hormones.

  IN PROKARYOTES: RNA polymerase binds directly to the promoter and starts transcription

  IN BOTH: Repressor proteins can bind to the promoter and prevent transcription. After transcription is initiated RNAP moves along the gene assembling the RNA molecule. It adds the 5' end of the free RNA nucleotide to the 3' end of the growing mRNA molecule, so transcription occurs in a 5' to 3' direction.
• What are the stages in gene expression?

  1. mRNA is produced through transcription

  2. mRNA is cut in post-transcriptional modification

  3. mRNA leaves the nucleus

  4. mRNA codes for polypeptides in translation
• What are nucleosomes and what do they do?

  Nucleosomes help to supercoil DNA. They are globular structures that have a core of eight histone protiens with DNA wrapped around. Another histone protein called H1 holds the DNA to the core, and a short section of linker DNA connects one nucleosome to the next.

  The eight histones in the core have N-terminal tails that extend out of the nucleosome, this is what DNA coils around.

  
• What are tandem repeats?

  Regions where adjacent section of DNA have the same base sequence.

  Examples:

  dimeric (ACACACACACACAC)

  tetrameric (GATAGATAGATAGATAGATAGATA)
• What are some examples of the functions of non-coding sequences of DNA?

  -Regulate gene expression: sites where proteins can bind that either promote or repress the transcription of an adjacent gene

  -Introns: Interruption of non-coding sequence in between coding sequences. They are removed from mRNA before it is translated and have many functions associated with mRNA processing

  -Telomeres: Repetitive base sequences at the end of DNA. Necessary because when DNA is replicated the end of the molecule cannot be replicated. Telomeres prevent important information from being lost.

  -Genes for tRNA and rRNA
• Explain Sanger Sequencing

  Sanger Sequencing is a method for base sequencing.

  1. DNA undergoes PCR to replicate

  2. Split into four vials labeled A,T,C and G

  3. Put in A,T,C and G dideoxynucleotides respectively (dideoxynucleotides are nucleotides with H not OH on the 3', and thus cannot bond with other nucleotides, ending the chain

  4. Run the vials through gel electrophoresis
• Explain the process of DNA replication.

  1. DNA gyrase relieves strain in DNA strand caused by the double helix being uncoiled

  2. Helicase uncoils the DNA double helix and splits it into two template strands. Single-stranded binding proteins keep the strands apart long enough to begin copying

  3. DNA primase adds a short length of RNA primer to allow DNA polymerase to bind

  4. DNA polymerase III adds nucleotides in a 5' to 3' direction

  5. On the lagging strand DNA is replicated in short lengths called Okazaki fragments

  6. DNA polymerase I removes the RNA primer and replaces it with DNA, a small nick is left in the sugar-phosphate backbone where the two nucleotides area unconnected

  7. DNA ligase seals up the nick by forming a sugar-phosphate bond
• Explain lagging and leading strands in DNA

  The two ends of the strands are different, one is a 5' and one is a 3'. This refers to which carbon the DNA phosphate is attached to. Replication allows follows in a 5' to 3' direction because that's how DNA polymerase works. Replication on the 5' to 3' strand (leading strand) is therefore continuous while replication on 3' to 5' (lagging strand, having to be done in small fragments, is discontinuous. The two strands of DNA are known as anti-parallel