Centrale dogma van de moleculaire biologie

    Cards (126)

    • What are the steps of protein synthesis shown in the image?
      • Transcription: DNA is transcribed into pre-mRNA
      • mRNA is processed and transported to the ribosome
      • Translation: mRNA is translated into a polypeptide chain at the ribosome
    • What are the key differences between transcription and translation in protein synthesis?
      • Transcription occurs in the nucleus, translation occurs in the cytoplasm
      • Transcription produces mRNA, translation produces polypeptides
      • Transcription uses DNA as the template, translation uses mRNA as the template
    • Wat zijn de stappen in het proces van eiwitsynthese?
      1. Transcriptie: DNA naar RNA
      2. Translatie: RNA naar eiwitten
    • Hoe verschilt de rol van DNA van die van RNA in eiwitsynthese?
      DNA bevat informatie, RNA codeert voor eiwitten
    • How does the structure of DNA differ from that of RNA?
      DNA is double-stranded; RNA is single-stranded
    • Wat bevat DNA?
      Genetische informatie
    • What is the role of the RNA polymerase enzyme shown in the image?
      It transcribes the DNA into pre-mRNA
    • If the DNA sequence is ATCGATTACGATCGATTACG, what would the corresponding mRNA sequence be?

      AUCGAUUACGAUCGAUUACG
    • What is the name of the molecule shown in the image?
      DNA
    • Wat zijn de belangrijkste structurele verschillen tussen DNA en RNA?
      • Suiker: Deoxyribose (DNA) vs Ribose (RNA)
      • Vorm: Dubbele helix (DNA) vs Enkele streng (RNA)
      • Thymine: Aanwezig in DNA, afwezig in RNA (vervangen door Uracil)
    • Wat is de suikercomponent van RNA?
      Ribose
    • What is the name of the structure shown in the image?
      Chromosome
    • Wat is de vorm van RNA?
      Enkele streng
    • What is the process called where mRNA is translated into a polypeptide chain?
      Translation
    • Wat is RNA?
      Ribonucleic Acid
    • Wat zijn codons in mRNA?
      Groepen van 3 basen
    • Wat gebeurt er met mRNA tijdens de translatie?
      Het wordt gelezen door ribosomen
    • How does the structure of the ribosome facilitate the translation process?
      • The small subunit binds the mRNA and positions it correctly
      • The large subunit provides the binding site for the tRNAs and catalyzes the formation of peptide bonds
      • The ribosome moves along the mRNA, adding one amino acid at a time to the polypeptide chain
    • Waarom zijn A en T altijd gekoppeld in DNA?
      Ze vormen specifieke waterstofbindingen
    • Wat is de rol van de genetische code?
      Het bepaalt de erfelijke eigenschappen van een organisme
    • What is the function of the sugar-phosphate backbone in DNA and RNA?
      * Provides structural support
      * Links together the nitrogenous bases
    • What are the four chemical bases that make up DNA?
      Adenine, Thymine, Guanine, Cytosine
    • How does the structure of a peptide bond allow for the formation of proteins?
      • The carbonyl carbon and amino nitrogen allow for the formation of a covalent bond between amino acids.
      • This allows long chains of amino acids (polypeptides) to be formed, which then fold into the 3D structure of proteins.
    • What is the purpose of the DNA sequence shown in the image?
      It represents the genetic information stored in a chromosome
    • Wat is de structuur van een gen?
      Een DNA dubbele helix
    • What are the key features of a chromosome based on the information provided in the image?
      • Composed of a long, double-stranded DNA molecule
      • Contains the genetic information for an organism
      • Organized into a compact, rod-like structure
      • Plays a crucial role in cell division and inheritance
    • What is the name of the compound formed in the condensation of ketones and aldehydes?
      β-hydroxyacarbonyl
    • Wat is de rol van ribosomen tijdens de translatie?
      Ze lezen codons één voor één
    • What is the role of the hydroxyl group (OH-) in the condensation of ketones and aldehydes?
      It is formed as an intermediate during the nucleophilic addition-elimination reaction
    • Wat gebeurt er tijdens een condensatiereactie?
      Water wordt afgesplitst tijdens bindingvorming
    • Wat is het effect van een verandering in de basensequentie van een gen?
      Het kan de eigenschappen van het organisme veranderen
    • What is the purpose of the peptide bond in proteins?
      It links amino acids together to form the polypeptide chain of proteins
    • If you wanted to determine the primary structure of a protein, which technique would you use?
      Amino acid sequencing
    • What is the quaternary protein structure?
      • Quaternary protein structure is a protein consisting of more than one amino acid chain
    • Wat zijn de twee vormen van secundaire structuur in eiwitten?
      Alfa-helices en geplooide vellen
    • Wat bouwt tRNA aan tijdens de translatie?
      Een polypeptide keten
    • What is the secondary protein structure?
      • Secondary protein structure is the hydrogen bonding of the peptide backbone causing the amino acids to fold into a repeating pattern
    • What is the tertiary protein structure?
      • Tertiary protein structure is the three-dimensional folding pattern of a protein due to side chain interactions
    • Waarom zijn C en G altijd gekoppeld in DNA?
      Ze vormen specifieke waterstofbindingen
    • What colors are the molecules shown in the image?
      • Red and blue