Definition and types: substitution, deletion, insertion

• What type of mutation is shown second in the image?

  Insertion
• What analogy is used to explain gene mutations?

  A typo in a long sentence
• What is a deletion mutation?

  Removal of one or more base pairs
• What causes gene mutations?

  Spontaneous errors or external mutagens
• In the image, what happens to the original sequence during a substitution mutation?

  One base is replaced by another
• What are the characteristics of gene mutations?

  They are permanent changes in DNA
• In the image, what happens to the original sequence during a deletion mutation?

  A base is removed from the sequence
• What is a substitution mutation?

  One base pair is replaced with another
• What is the effect of a substitution mutation on the mRNA codon?

  It can alter the mRNA codon
• What consequence can deletion mutations cause?

  A frameshift altering the reading frame
• What analogy is used to explain deletion mutations?

  Removing 'e' from "The cat sat"
• What are the consequences of gene mutations?

  • Can be harmful
  • Can be beneficial
  • Can have no noticeable effect
• What are the three main types of gene mutations?

  • Substitution
  • Insertion
  • Deletion
• What is the difference between microdeletion and macrodeletion?

  • Microdeletion: Deletion of a small segment of DNA
  • Macrodeletion: Deletion of a larger segment of DNA
• What is the DNA sequence after macroinsersion?

  GTCGAGTCTACGCCTATCGCT CAGCTCAGATCGCGAGAGCCA
• In the substitution mutation shown, which base is replaced with which?

  G is replaced with A
• In the image, what happens to the original sequence during an insertion mutation?

  A base is added into the sequence
• How does an insertion mutation occur?

  An extra nucleotide is added to the sequence
• How does a microdeletion visually appear in DNA?

  As a small gap in DNA sequence
• What is the change in DNA for a substitution mutation?

  It replaces a base
• How does a deletion mutation occur?

  A nucleotide is removed from the sequence
• How can mutations impact organisms?

  They can be harmful, beneficial, or neutral
• What analogy is used to explain insertion mutations?

  Inserting "big" into "The cat sat"
• How can the DNA sequence be used to differentiate between microdeletion and deletion?

  Microdeletion shows a smaller segment missing, deletion shows a larger segment missing
• Does substitution cause a frame shift?

  No
• How does a deletion mutation affect protein function?

  It often results in a non-functional protein
• What can a change in the mRNA codon lead to?

  A different amino acid being incorporated
• What are the potential effects of mutations?

  They can be harmful, beneficial, or neutral
• What is the scope of a microinsertion mutation?

  Adds 1-2 bases
• How does an insertion mutation affect protein function?

  It often results in a non-functional protein
• How does a substitution mutation affect protein synthesis?

  It may incorporate a different amino acid
• What are the potential results of mutations?

  Different versions of genes called alleles
• What is the DNA sequence before macroinsersion?

  GTCGAGTCTACGCCTATCGCT CAGCTCAGATCGCGAGAGCCA
• What is the definition of gene mutations?

  Alterations in the $DNA$ sequence
• What is an insertion mutation?

  Addition of one or more base pairs
• What are gene mutations?

  Alterations in the DNA sequence
• What are the key differences between substitution, deletion, and insertion mutations?

  • Substitution: Replaces a base, no frameshift, may alter one amino acid.
  • Deletion: Removes a base, causes frameshift, often non-functional protein.
  • Insertion: Adds a base, causes frameshift, often non-functional protein.
• How many nucleotides are added during macroinsersion?

  16
• What is an insertion mutation?

  Extra nucleotide base pairs added to DNA
• What can a substitution mutation alter?

  The $mRNA$ codon and amino acid