Lesson 1-3

• Genetic Engineering


  The artificial manipulation, modification, and recombination of DNA or other nucleic acid molecules in order to modify an organism or population of organisms
• Genetic Engineering


  • Initially referred to various techniques used for the modification or manipulation of organisms through the processes of heredity and reproduction
  • The term embraces both artificial selection and all the interventions of biomedical techniques (artificial insemination, in vitro fertilization, cloning, and gene manipulation)
  • The process of using recombinant DNA (rDNA) technology to alter the genetic makeup of an organism. Most often, a gene from another species is added to an organism's genome to give it a desired phenotype
• Classical Plant Breeding


  • Uses deliberate interbreeding of closely or distantly related individuals to produce new crop varieties or lines with desirable properties
  • Plants are crossbred to introduce traits/genes from one variety or line into a new genetic background
• Purposes of Genetic Engineering

  • Introduction of new traits into an organism
  • Enhancement of a present trait by increasing the expression of the desired gene
  • Enhancement of a present trait by disrupting the inhibition of the desired genes' expression
• Genetic Engineering Process


  1. Cutting or cleavage of DNA by restriction enzymes (REs)

  2. Selection of an appropriate vector or vehicle which would propagate the recombinant DNA (e.g. circular plasmid in bacteria with a foreign gene of interest)

  3. Ligation (join together) of the gene of interest (e.g. from an animal) with the vector (cut bacterial plasmid)

  4. Transfer of the recombinant plasmid into a host cell that would carry out replication to make huge copies of the recombined plasmid

  5. Selection process to screen which cells actually contain the gene of interest

  6. Sequencing of the gene to find out the primary structure of the protein
• Biolistics


  • A "gene gun" is used to fire DNA-coated pellets on plant tissues
  • Cells that survive the bombardment, and are able to take up the expression plasmid coated pellets, acquire the ability to express the designed protein
• Plasmid Insertion by Heat Shock Treatment

  1. The target cells are pre-treated before the procedure to increase the pore sizes of their plasma membranes

  2. After the cells are made competent, they are incubated with the desired plasmid at about 4°C for about 30 mins

  3. A "Heat Shock" is done on the plasmid-cell solution by incubating it at 42°C for 1 minute then back to 4°C for 2 minutes

  4. The rapid rise and drop of temperature is believed to increase and decrease the pore sizes in the membrane

  5. The plasmid DNA near the membrane surface are taken into the cells by this process. The cells that took up the plasmids acquire new traits and are said to be "transformed"
• Electroporation


  • Follows a similar methodology as Heat Shock Treatment, but the expansion of the membrane pores is done through an electric "shock"
  • Commonly used for insertion of genes into mammalian cells
• Selection Methods


  • Selection of plasmid DNA containing cells
  • Selection of transformed cells with the desired gene
  • PCR detection of plasmid DNA
• Genetically Modified Organisms (GMOs)


  Organisms that have had their genetic material altered using genetic engineering techniques
• Examples of Modified Traits and Applications

  • Insulin Production: Insertion of Human Insulin Gene into Bacteria (Medicine)
  • Pest Resistance: Insertion of Bt-toxin gene into Corn/Maize (Agriculture)
  • Delayed Ripening: Disruption of a gene for a ripening enzyme (e.g. polygalacturonase) in Tomato plant (Agriculture)
  • Chymosin Production: Insertion of a gene for chymosin into Bacteria (Industry)
• Detection of Desired Traits


  • Researchers may test the DNA of different organisms for the presence of specific genes through PCR
  • PCR amplification is an in-vitro method that simulates DNA replication in vivo
  • Uses a thermostable DNA polymerase that builds single stranded DNA strands unto unwound DNA templates
  • Uses repeated cycles of incubation at different temperatures to promote the unwinding of the DNA template, the annealing of a primer, and the extension of the generated ssDNA strand
  • Each cycle of PCR doubles the amount of the target sequence
  • Involves the design of primers that would only bind to sequences that are specific to a target
• Steps in PCR Amplification

  1. Undenatured Template

  2. Template Denaturation

  3. Primer Annealing

  4. New DNA Strand Elongation
• DNA Separation


  1. bonds between complementary sequences are broken
• Coding strand

  5' A T GCGATGAGGATATGACCCGAT AGATAGAGGTATCTAGAGAT 3'
• Non-coding strand

  3' T A CGCTACTCCTATACTGGGCT ATCTATCTCCATAGATCTCTA 5'
• Primer Annealing


  1. Template: ssDNA strands

  2. H-bonds are formed between complementary sequences on the primers and the target sequences

  3. Direction of elongation: Forward Primer 5' GCGATGAGG 3'

  4. Direction of elongation: Reverse Primer CCATAGATC
• New DNA Strand Elongation

  1. The two new dsDNA strands are formed by the elongation of the generated ssDNA and the H-bonds between the complementary sequences on these new strands and their templates

  2. Each of the new dsDNA strands is made up of one old strand from the original template, and one new strand that was generated as a reverse complement of the template

  3. This is called semiconservative replication of the sequence
• New Strand 1


  5' A T GCGATGAGGATATGACCCG ATAGATAGAGGTATCTAGAGAT 3' (Coding strand) (old)

  3' CGCTACTCCTATACTGGGCTA TCTATCTCCATAGATC-5' (Reverse Primer) (new)
• PCR Amplification


  Repeat step 1 to 3 for N number of cycles (N is usually 35)
• PCR Results


  • The expected product of PCR amplification will depend on the sequences/position at which the primer sequences bind
• PCR Applications


  • Detect the presence of a desired gene in an organism

  Cloning and Expression (e.g. insertion of an insulin-coding gene from the human genome into bacteria)
• Geological Time Scale (GTS)

  • Precambrian
  • Paleozoic
  • Mesozoic
  • Cenozoic
• Periods under the Paleozoic era

  • Cambrian
  • Ordovician
  • Silurian
  • Devonian
  • Carboniferous
  • Permian
• Periods under the Mesozoic era


  • Triassic
  • Jurassic
  • Cretaceous
• Periods under the Cenozoic era


  • Tertiary
  • Quaternary
• Cambrian Explosion


  • Sudden, apparent explosion of diversity in life forms about 545 million years ago

  Created the complexity of multi-celled organisms in a relatively short time frame of 5 to 10 million years

  Created most of the major extant animal groups today
• Types of Fossils


  • Molds
  • Casts
  • Petrified
  • Original Remains
  • Carbon Film
  • Trace/ Ichnofossils
• The Six Ways of Fossilization


  • Unaltered preservation
  • Permineralization/ Petrification
  • Replacement
  • Carbonization or Coalification
  • Recrystalization
  • Authigenic preservation
• Relative Dating


  Based upon the study of layer of rocks

  Does not tell the exact age: only compare fossils as older or younger, depends on their position in rock layer

  Fossils in the uppermost rock layer/ strata are younger while those in the lowermost deposition are oldest
• Rules of Relative Dating

  • Law of Superposition

  Law of Original Horizontality

  Law of Cross-Cutting Relationships

  Index Fossils (guide fossils/ indicator fossils/ zone fossils)
• Absolute Dating


  Determines the actual age of the fossil

  Through radiometric dating, using radioactive isotopes carbon-14 and potassium-40

  Considers the half-life or the time it takes for half of the atoms of the radioactive element to decay

  The decay products of radioactive isotopes is stable atoms