Review M3&4

• Dr. Lovaye Kajiura: 'No part of this lecture may be reproduced, in any form or by any means, without permission in writing by the Biology 1A03 professor Dr. Lovaye Kajiura. No visual media, voice recordings, PowerPoint slides, pdfs, MP3, MP4 media, or lecture-related information may be reproduced or communicated by any means. Copying Biology 1A03 lecture materials for distribution, for example uploading materials to a commercial website, is strictly prohibited.'
• Copyright 2024 © L. Kajiura, McMaster University, Biology 1A03
• We take this time to recognize that we are currently on the traditional territory shared between the Haudenosaunee confederacy and the Anishinabe nations, which was acknowledged in the Dish with One Spoon Wampum belt.
• That wampum uses the symbolism of a dish to represent the territory, and one spoon to represent that the people are to share the resources of the land and only take what they need.
• THEME 4 DNA Replication & Mitosis
• REVIEW LECTURE
• Module 3 Applications of DNA Replication & Module 4 DNA Mutations
• DNA Sequencing


  Knowing the sequence of a gene is useful in order to understand its function & to figure out the amino acid sequence & the function of its product
• Whole Genome Sequencing


  1. Phase 1: SEQUENCE DNA

  2. Phase 2: ASSEMBLE the Sequences

  3. Phase 3: ANNOTATE the Sequences
• Dideoxynucleotides


  Lack an OH group on the 3'carbon of the sugar, therefore DNA polymerase cannot add another nucleotide to the growing DNA strand once a ddNTP has been added
• Replication Stops at Chain Terminator
• Each terminator is fluorescently labelled
• Phase 1: Sequenced DNA Fragments

  In pieces
• Phase 2: Assembly of Overlapping DNA Sequences


  Assembled Sequence: GCTATCAGGCTAGGTTACAGTGCATGCATACACGTAGCTATAC
• Assembly is based on Sequence Similarities
• Six Reading Frames for any double stranded DNA sequence

  Any double-stranded region of DNA can potentially be read in 6 ways: three reading frames using each of the two single strands as a template
• But only one reading frame codes for the protein
• Annotation - Identifying functional sequences

  • Sequences that might form typical RNA secondary structures
• Phase 3 - Gene Annotation


  The process of identifying the locations of genes & all of the coding regions in a genome & determining what those genes do
• Consequences of DNA Damage

  • Cell death
  • Cancer
  • Aging
  • Disease
• Causes of DNA Damage

  • Mutagens
  • X-rays
  • Oxygen radicals
  • UV light
  • Replication errors
• DNA Repair Mechanisms


  • Base-excision repair (BER)
  • Nucleotide-excision repair (NER)
  • Mismatch repair
• Base Excision Repair


  Apurinic/apyrimidinic (AP) endonuclease
• A Point Mutation
• Silent Mutations


  Due to the redundancy in the genetic code, a single nucleotide change in the 3rd position of the codon may not change the amino acid for which it is coded. If the amino acid sequence does not change, then the phenotype does not change.
• Nonsense Mutations
• Small Deletions Remove Amino Acids
• Frameshift Mutations
• Weblink - Types of Mutations
• Chromosomal Duplications & Deletions
• Chromosomal Inversions
• Reciprocal Translocations
• Polyploidy, trisomy, and other aneuploidy conditions are caused by nondisjunction
• APPLIED LECTURE
• Module 3 Applications of DNA Replication
• Module 4 DNA Mutations