fdg

• Charles Darwin proposed the theory of evolution in his book "On the Origin of Species"


  1866
• Survival of the Fittest


  Darwin's hypothesis
• Darwin's observations

  • Finches of the Galapagos Islands
• Johann Friedrich Miescher isolated nuclein in the nuclei of human white blood cells


  1869
• Nuclein


  Later renamed as deoxyribonucleic acid (DNA)
• Albrecht Kossel discovered a fibrous structure in the nucleus of cells, which he named chromatin, and observed how chromosomes separate during cell division or mitosis


  1885-1901
• Kossel was unaware of Mendel's laws which did not make him the connection between his observations and genetic inheritance
• Walter Sutton and Theodor Boveri independently developed the chromosome theory of inheritance


  1902-1903
• Chromosome theory of inheritance

  • Chromosomes contain the genetic material
  • Chromosomes are passed along from parent to offspring
  • Chromosomes are found in pairs in the nucleus of most cells
  • Chromosomes separate during the formation of sperm and egg cells in men and women
  • Each parent contributes one set of chromosomes to its offspring
• Erwin Chargaff discovers that DNA composition is species specific


  1950
• Chargaff's rule


  • # of guanine units = # of cytosine units
  • # of adenine units = # of thymine units
• Rosalind Franklin produced high-resolution photographs of DNA fibers through X-ray diffraction, and thought that the DNA molecule probably has a helical structure


  1952
• Franklin came close to discovering the structure of DNA, yet was beaten by Thomas Watson and Francis Crick
• James Watson and Francis Crick solved the mystery of the structure of DNA, which is double helical, using the photographs by Franklin


  1953
• Watson, Crick, and Maurice Wilkins were awarded the Nobel Prize for Physiology and Medicine in 1962, but Franklin wasn't honoured for her contribution in the discovery
• DNA


  The nucleic acid that contains the genetic code of organisms, the "blueprint" of life
• Functions of DNA


  • Heredity - pass down from parent to offspring
  • Gene expression - DNA dictates what characteristics individuals have
  • Mutation - changes in DNA
• Features of DNA

  • Double helix structure - there are two strands intertwined around each other, each with a sugar backbone named deoxyribose and nitrogenous bases
  • Anti-parallel strands - one strand goes from 5' to 3' and the other goes from 3' to 5'
  • Complementary base pairing - A always pairs with T and C always pairs with G (in RNA, U replaces T)
• Central Dogma of Molecular Biology


  Explains the flow of genetic material from DNA to RNA to protein (a functional product), suggesting that DNA is the source of the information to make proteins and RNA acts as a messenger to carry this information to the ribosomes
• Central Dogma of Molecular Biology

  1. DNA Replication

  2. RNA Transcription

  3. Protein Translation
• DNA Replication


  Process by which DNA makes a copy of itself during cell division
• DNA Replication


  • Occurs in the cytoplasm of prokaryotes and in the nucleus of eukaryotes
  • Can be continuous or discontinuous
  • Occurs during the S phase of Interphase of the Cell Cycle
  • Involves the use of enzymes
• DNA Replication


  1. Initiation

  2. Elongation

  3. Termination
• Helicase


  The enzyme that is responsible for unzipping the DNA molecule during replication
• DNA Polymerase


  The enzyme that replicates DNA molecules that actually builds a new strand of DNA
• Primase


  The enzyme that puts RNA primers wherein DNA polymerase starts replication
• Ligase


  The enzyme that connects or "glues" DNA fragments together
• Initiation


  1. Replication starts at sites called origins of replication

  2. Helicase unwind the double helix structure by breaking the hydrogen bonds between the base pairs

  3. Topoisomerase surrounds the strands and prevents supercoiling

  4. Primase creates short sequences of RNA that provide a starting point for replication
• Elongation


  1. DNA Polymerase can only replicate in the 5' to 3' direction

  2. Leading strand: 3' to 5' direction

  3. Lagging strand: 5' to 3' direction

  4. Continuous replication happens in the leading strand

  5. Discontinuous replication happens in the lagging strand
• Discontinuous Replication


  • Repeatedly putting of primers by primase and the replication of DNA polymerase
  • Makes small fragments of DNA called Okazaki fragments
• Termination


  1. DNA replication ends if there is either no more DNA template to replicate or two replication forks meet

  2. Okazaki fragments are glued together by ligase, creating one complete strand

  3. DNA polymerase proofreads the DNA for errors before replication ends
• 3'- ATATATAATATATCCGATCGATGC -5'


  TATATATTA