Biotechnology

• Recombinant DNA

  The alteration of genetic material (outside and/or inside) an organism to obtain enhanced and desired characteristics in living organisms
• Genetic engineering


  The alteration of genetic material (outside and/or inside) an organism to obtain enhanced and desired characteristics in living organisms
• Hungarian engineer Karl Ereky coins 'biotechnology'

  1917
• Biotechnology

  All lines of work by which products are produced from raw materials with the aid of living things
• Molecular biotechnology


  Specifically involves the modification of nucleic acids, normally to optimise the production of a product
• Applications of recombinant DNA technology

  • Agriculture (transgenic plants for drought/disease resistance)
  • Forensic use (DNA profiling)
  • Medical research (detecting genetic disorders, gene therapy, producing therapeutic agents)
  • Human genome project (genetic mapping, DNA sequencing, genome analysis/comparison)
  • Vaccine production
  • Research (understanding the function of genes)
• Genetic engineering in practice

  1. Identify the gene of interest (GOI)

  2. Find a method of replicating (copying) the gene – PCR

  3. Find a method of transferring the GOI into the recipient organism

  4. Integrate the amplified GOI into plasmid vector

  5. Transform plasmid into host cell

  6. Find a method of checking for successful transformants
• Cloning

  In biotechnology, "cloning" refers to processes used to create exact genetic copies of: DNA fragments (gene/DNA cloning), Cells (cell cloning, e.g. therapeutic cloning), Organisms (reproductive cloning)
• Clones occur naturally through asexual reproduction and when a fertilized egg splits, creating two or more embryos that carry almost identical DNA
• Animal cloning

  • 1996: Dolly the sheep, the first mammal to be cloned from adult genetic material, was born
  • 2018: Zhong Zhong and Hua Hua, the world's first monkeys cloned from fetal fibroblasts
• Therapeutic cloning

  Cloning for medical purpose, research
• Reproductive cloning

  Cloning livestock, cloning endangered species
• DNA / Gene / Molecular cloning

  Creates multiple identical copies of well-defined DNA segments
• Vector

  A section of DNA that can incorporate another DNA fragment without losing the capacity for self-replication
• Hybrid vector

  A vector containing an additional DNA fragment
• Gene cloning

  The process of inserting a fragment of DNA that includes one or more genes into a vector
• Plasmid

  Small circular DNA molecules that replicate separately from the bacterial chromosome
• Recombinant DNA


  A molecule with DNA from two different sources
• Plasmid cloning in bacteria

  1. Amplify the gene of interest (GOI) by PCR

  2. Integrate the amplified GOI into plasmid vector

  3. Transform recombinant plasmid into host cell (E. coli)

  4. Validate successful transformants
• Polymerase chain reaction (PCR)

  Specific DNA fragment amplification in vitro, based on the DNA replication process catalysed by DNA polymerase
• Primer

  Needed because DNA polymerase can add a nucleotide only onto a pre-existing 3′-OH group
• PCR reaction


  1. Denaturation: separates the two nucleotide strands of the template DNA molecule

  2. Annealing: the primers bind to the single-stranded template DNA

  3. Extension: nucleotides are added to the primers - in the 5' to 3' direction by DNA polymerase: forms a double stranded copy of the target DNA
• PCR

  • Each cycle takes just seconds to a few minutes, so repeated cycles can produce large amounts of a specific DNA sequence in hours
  • Some details about the nucleotide sequence to be copied must be known in advance to design primers
• PCR components

  • Template DNA: typically genomic DNA containing GOI
  • Primers: designed and synthesised to amplify the target region
  • DNA Polymerase: thermally stable, active at 72°C
  • Buffer: contains cofactor for DNA Pol and dNTPs
• DNA Pol often pre-mixed with buffer and other components in a x2 "master mix"
• Primer design

  • Length of 18-24 bases
  • 40-60% G/C content
  • Melting temperature (Tm) of 50-60°C
  • Tm is a function of length and G/C %
  • Primer pairs should have a Tm within 5°C of each other
  • Repetitive / complementary sequence can lead to secondary structure
• Extension time: 60s, Annealing temperature: 55°C, Denaturation temperature: 95°C
• Predicted PCR product size from green primer pair: 210bp, from blue primer pair: 280bp
• The primer with sequence GCCTTACGACAGGTACGGCT is most likely to have the highest Tm
• The primer with sequence GCATATATGCTATATAC is most likely to have strong secondary structure
• Restriction endonucleases

  Enzymes that cleave DNA at specific sequences, called restriction sites
• Sticky ends


  Staggered DNA fragments produced by restriction enzymes, which can ligate with complementary sticky ends
• DNA Ligase

  Enzyme that seals the ligation of complementary restriction fragments
• Multiple cloning sites (MCS)

  In plasmid vectors
• Plasmid vectors used for expression of a GOI

  • Self-replicating (functional ori)
  • Selectable marker e.g. antibiotic resistance
  • Carry the GOI into a host system where the gene can be expressed
  • Include regulatory sequences necessary for the transcription of the gene and translation of the protein
  • Often expression is inducible
• Selectable marker


  Antibiotic resistance, β-galactosidase activity
• We can run DNA samples on an agarose gel of our cloned plasmids from transformants to check they are correct
• Expected PCR product size with primer pair covering the MCS on cloned plasmid: 950bp
• Expected product sizes from EcoRI digest: Empty plasmid: 3000bp, Cloned plasmid: 3800bp
• Recombinant human insulin in E. coli

  • Insulin replacement therapy is the standard of care for patients with type 1 and advanced type 2 diabetes mellitus
  • Recombinant (biosynthetic) human insulin became available in large amounts by biosynthesis in Escherichia coli