Feedback

• Reverse transcriptase


  What enzyme uses RNA as template to produce a DNA copy?
• Deletion of one amino acid at position 508


  Which of the following best describes the genetic mutation in Cystic Fibrosis?
• Numerical


  Which disorder will result when there is change in the number of chromosomes?
• HEXA


  Mutation on which of the following genes would result in the accumulation of GM2 ganglioside in the lysosomes of neurons?
• Structural


  Which disorder will result from breakages within the chromosome?
• Abnormal hemoglobin results in prolonged clotting


  All of the following are true of sickle cell anemia EXCEPT:
• Multifactorial inheritance


  This type of genetic disorder is caused by the combination mutations and environmental factors in multiple genes is called ____________________.
• False


  Chromosomal duplications occur when there is an extra copy of segment of chromosome and otherwise known as partial monosomies.
• Mousy


  The characteristic urine odor produced by a patient with Phenylketonuria is:
• Ectopia Lentis


  The following our seen in patients with achondroplasia, except:
• True


  Chromosomal deletions occur when a piece sections of chromosomal material is missing and is also known as partial monosomies.
• Cystic fibrosis


  Which disorder affects the exocrine glands and causes an inability to secrete chloride at the surface of cells?
• Interstitial


  A type of chromosomal deletion resulting the loss of material from within the chromosome is called _______________.
• Guide RNA


  Which component of a CRISPR-Cas9 system is designed and synthesized to direct which DNA sequences are removed?
• FGFR3


  Which gene provides instructions for making a protein that is involved in the development and maintenance of bone and brain tissue?
• FBN1


  Marfan syndrome is caused by defects or deletions of which gene?
• Microdeletions


  A type of chromosomal deletions that are too small to be seen under the microscope is:
• - individual carries two mutant versions (alleles) of the relevant gene

  - occurs only in the homozygous state

  - carriers of a mutant allele do not show symptoms of the disease


  Which of the following describe recessive disorders? (Select all possible answers)
• The PCR reaction will not commence


  What would be the effect on the PCR reaction if any of the following arises:

  1) there are no primers in the reaction

  2) there are no dNTPs in the reaction

  3) there is no Taq polymerase in the reaction?
• There is a deficiency of Factor IX.


  The following statements are true of Hemophilia A EXCEPT:
• Hemophilia


  Which of the following is NOT an example of multifactorial inheritance disorders?
• Balance translocations


  Which type of genetic disorder occurs when a segment in chromosome is transferred from one chromosome to another but no detectable net gain or loss of DNA?
• -Caused by a defect in the gene that helps control the production of the globin chains

  -A person must have mutations in both copies of the relevant gene in order to have the disease


  Which of the following statements is true of Thalassemia? (Select all possible answers)
• True


  Paracentric inversions occur when a chromosome breaks in two places and will result to re-insertion of DNA into the chromosome outside the centromere.
• cutting double-stranded RNAs into short pieces


  Which of the following describes the role of the enzyme dicer in gene silencing?
• Dwarfism


  Which of the following is a characteristic feature of achondroplasia?
• 4


  If the following DNA is cut by AluI, how many fragments will there be? 5'GTTACACTCAGCTCTCTAAGCCAGCTCTCATGCGCCTAAAGCTGACGTGAATGCACGTCCA3'?
• Isochromosomes


  Abnormal chromosomes with identical arms-either two short (p) arms or two long (q) arms are referred to as:
• 3


  If an intact plasmid is cut into three pieces when treated with a restriction enzyme, how many restriction sites for this enzyme are present in the plasmid?
• negative ; positive


  DNA electrophoresis is based on the fact that DNA has a _____ charge and therefore migrates toward the ____ electrode

  Correct!
• Ring chromosomes


  This type of chromosomes from when the ends of both arms of the same chromosomes are deleted, causing the remaining broken ends of the chromosomes to be "sticky".
• sonoporation


  Which gene transfer technique involves the use of sound waves to deliver a gene of interest into a cel
• DMD


  Which of the following genes control the production of a protein that play an important role in maintaining the sarcolemma of muscle cells?
• Dicentric chromosomes


  This type of chromosomes results from the abnormal fusion of two chromosome pieces, each of which includes a centromere.
• the DNA primers attached to the end of the desired gene


  During the elongation step in PCR, Taq polymerase starts copying at _____________.
• single-stranded DNA sequences that are generated by staggered cuts.


  The cohesive ends of restriction fragments are ____________.
• Isochromosomes


  Pallister-Killian syndrome is an example structural disorder called __________.
• Every cell


  Transgenic eukaryotic organisms carry the transgene in _____________.
• Northern blot


  Which blotting technique is used to find an RNA fragment within a sample that is complementary to a DNA probe?
• Terminal


  The term that is used to describe when there is just one break/missing part in the end of the chromosome is: