L7-9 quiz

• Huntington's disease is a progressive neurodegenerative disorder that affects the brain and spinal cord
• Huntington's disease is an autosomal dominant disorder
• Huntington's disease causes progressive neural degeneration and is late onset so no symptoms appear until about age 40
• sickle-cell anaemia is an example of a

  missense mutation
• sickle-cell anaemia arises from a substitution of glutamic acid by valine at position 6 in the globin chain
• first line of FASTA format gives the definition line, starting with >
• point mutations


  consist of a change in one or a few nucleotides of a DNA sequence (in a single gene)
• >gi|158341855|gb|EU051630.1| Zaire ebolavirus strain GOR1 Lossi spike glycoprotein precursor, gene

  ATGGGTATTACAGGAATATTGCAGTTACCTCGTGATCGATTCAAGAGGACATCATTCTTTCTTTGGGTAATTATCCTTTTCCAAAGAACATTTTCCATCCCACTTGGAATCATCCACAATAGCACATTACAAGTTAGTGATGTCGACAAACTAGTTTGTCGTGACAAACTGTCATCCACAAATCAATTGAGATCAGTTGGACTGAATCTCGAAGGGAATGGAGTGGCAACTGACGTGCCATCTGCAACTAAAAGATGGGGCTTCAGGTCCGGTGTCCCTCCAAAGGTGGTCAATTATGAAGCTGGTGAATGGGCTGAAAACTGCTACAATCTTGAAATCAAAAAACCTGA

   

  this is FASTA format
• translation initiation complex has:

  • small ribosomal subunit
  • mRNA
  • tRNA with methionine attached
  • initiation factor
• release factors terminate protein synthesis by recognising one of the 3 stop codons
• what are the 3 stop codons?

  UAA, UAG, UGA
• most common fatal genetic disorder of Caucasians is:

  cystic fibrosis
• around 1 in 20 Caucasians are carriers for cystic fibrosis, the fequency of the disease is:


  1 in 1600
• process is nucleotide excision repair

  
• to find more genome sequences related to one can be done using BLAST software
• caused by chemical mutagens:

  • mispairing due to additions of groups such as methyl
  • mispairing due to removal of amino group from cytosine or adenines
  • mispairing due to structural similarity with nucleotides
• UV irradiation can cause linking of pyrimidines in the same strand with covalent bonds