CHAPTER 10

• Structural genes


  Encode an amino acid sequence
• Messenger RNA (mRNA)


  The RNA that is transcribed from structural genes

  
• Garrod's experiments on genes and enzymes

  Early 1900s
• Garrod's experiments


  • Suggested a relationship exists between genes and protein production
  • Studied patients with the inherited disease alkaptonuria

  
• Alkaptonuria


  A disease where patients accumulate large amounts of homogentisic acid, causing the urine to appear black
• Alkaptonuria


  Inherited through a recessive pattern<|>Due to a defect in phenylalanine metabolism

  
• Garrod's description of alkaptonuria


  An inborn error of metabolism associated with the production of a defective enzyme

  
• One gene-one enzyme theory

  Proposed by Beadle and Tatum after studying nutritional requirements in the bread mold Neurospora crassa

  
• Minimal medium


  Contains a carbon source, inorganic salts, and biotin
• Beadle and Tatum's results led them to propose the one-gene-one-enzyme theory
• Since then, there have been some slight modifications to the one-gene-one-enzyme theory
• Translation


  Involves an interpretation of the language of mRNA (nucleotides) into the language of proteins (amino acids)

  
• Codon


  A sequence of three bases within the mRNA that is read
• Start codon

  AUG, indicates the beginning of a polypeptide sequence

  
• Stop codons

  UAA, UAG, and UGA, end translation
• The genetic code is nearly universal, with only a few exceptions discovered

  
• Open reading frame (ORF)


  A sequence of codons that defines the sequence of the polypeptide
• mRNA sequence encoding a short polypeptide with 7 amino acids

  • AUGCCCGGAGGCACCGUCCAAU
  • Met - Pro -Gly -Gly -Thr - Val - Gln

  
• mRNA sequence with base C adjacent to the start codon removed

  • AUGCCGGAGGCACCGUCCAAU
  • Met - Pro -Glu -Ala - Pro -Ser - Asn

  
• mRNA sequence with three bases (CCC) next to start codon removed

  • AUGGGAGGCACCGUCCAAU
  • Met - Gly -Gly -Thr - Val - Gln

  
• Polypeptide chain directionality


  Parallels the direction of the mRNA chain

  
• Peptide bond


  Formed between the carboxyl group of the last amino acid and the amino group of the amino acid being added

  
• 1. terminal/amino terminal end


  The first amino acid of the polypeptide
• 1. terminal/carboxyl terminal end


  The last amino acid of the polypeptide
• Types of amino acids

  • Aliphatic and aromatic (nonpolar, hydrophobic)
  • Polar (hydrophilic)

  
• Primary structure


  The defined amino acid sequence of a polypeptide

  
• Secondary structures


  Regular, repeating shapes like α-helices or β-sheets, stabilized by hydrogen bonds
• Tertiary structures

  Formed due to hydrophobic/hydrophilic interactions, ionic interactions, van der Waals interactions, and hydrogen bonding
• Quaternary structure


  Proteins that contain more than one polypeptide
• tRNA


  Carries the correct amino acid to the site of polypeptide synthesis

  
• Anticodon


  On the tRNA, binds to the codon on the mRNA

  
• The cell must produce many different tRNAs to address the needs of the genetic code
• Structural features of tRNA

  • Three stem loop structures
  • A variable region
  • An acceptor stem with a 3' single-stranded region
• In all tRNAs, the nucleotides at the 3' end contain the sequence CCA

  
• The anticodon is located in the second loop region of tRNA

  
• Aminoacyl-tRNA synthetase


  The enzyme that catalyzes the attachment of amino acids to the 3' end of the tRNA

  
• Aminoacyl-tRNA synthetase catalysis

  1. Reaction between an amino acid, a tRNA, and ATP

  2. Produces a charged tRNA/aminoacyl-tRNA

  
• Wobble rule

  The genetic code is degenerate, with more than one codon specifying the same amino acid<|>Degeneracy occurs at the third position in the codon<|>The base at the third position in the codon does not have to hydrogen bond as precisely with the corresponding base in the anticodon

  
• Isoacceptor tRNA


  Two or more tRNAs that differ at the wobble base but are able to recognize the same codon

  
• Ribosome


  The site of translation in both bacterial and eukaryotic cells