Genetic Mapping & Linkage Analysis

• All people in the population
• Genetic counsellor wants to determine the risk of a couple to have a child with Tay-Sachs disease


  1. The woman is a known carrier of a heterozygous mutation in HEXA

  2. The partner, who is of Ashkenazi Jewish descent, has not been analysed so far

  3. Estimate the frequency of heterozygous mutations in HEXA
• The incidence of Tay-Sachs disease in Ashkenazi Jews is approximately 1 / 2,000
• p²


  Probability for AA (homozygous/unaffected)
• q²


  Probability for aa (affected)
• 2pq


  Probability for Aa (heterozygous, carrier)
• p + q = 1
• Carrier: 2pq
• Frequency of heterozygotes is approximately 1/23
• Assumptions behind Hardy-Weinberg equilibrium

  • Large Population Size
  • Random Mating
  • No Mutation
  • No Migration
• How disease genes have been found

  1. Genetic mapping for monogenic diseases

  2. Genetic markers as signposts for mapping genes

  3. LOD score: using pedigree to locate disease gene

  4. Homozygosity mapping: zooming into the disease gene

  5. Exome sequencing: using NGS to locate the disease gene
• Genetic testing in research

  Helps to understand the pathological basis of a genetic disease
• Genetic testing in service

  Establishes a (molecular) diagnosis for an undiagnosed patient
• Approaches to finding disease genes


  • Finding disease genes using genetic linkage and high-throughput sequencing
  • Finding disease genes by positional approaches
  • Finding disease genes by exome/genome sequencing
• Mendel's principles


  • The principle of uniformity
  • The principle of segregation
  • The principle of independent assortment
• The principle of independent assortment


  Separate loci segregate to offspring independently of one another. The distribution of two phenotypes will be 9 (dominant allele each) to 3 (one dominant, one recessive allele) to 3 (one recessive, one dominant allele) to 1 (recessive alleles each).
• Genetic recombination


  Can occur after crossover between two chromatids of homologous chromosomes. Non-recombinant chromosomes (N) carry a combination of marker alleles A1B1 or A2B2; recombinant chromosomes (R) carry a combination of marker alleles A1B2 or A2B1.
• Recombination frequency


  The frequency of recombination between two loci correlates with their distance on a genetic map (genetic distance). A recombination frequency of 1% equates to a recombination fraction of 0.01, which equates to a genetic distance of 1 cM.
• Drosophila


  • X chromosome
• Genetic marker


  A gene or DNA sequence with a known location on a chromosome. It can be described as a variation that can be observed. A genetic marker may be a short DNA sequence, such as a sequence surrounding a single base-pair change (single nucleotide polymorphism, SNP), or a long one, like minisatellites.
• The evolution of human genetic markers


  • Blood groups
  • Serum proteins
  • HLA tissue types
  • RFLP
  • Minisatellites (VNTRs)
  • Microsatellites (STRs)
  • Single nucleotide polymorphisms (SNPs, SNVs)
• Informativity of a genetic marker

  Depends on the number of different alleles and the distribution of alleles in a population.
• SNP


  • Allele 1: CGGTAAACGATGCGTAAGT

  Allele 2: CGGTAAATGATGCGTAAGT
• Microsatellite


  • Allele 1: CGGTCACACACACACACAGGTCAATG

  Allele 2: CGGTCACACACACACACACACAGGTCAATG

  Allele 3: CGGTCACACACACACACACACACACAGGTCAATG

  Allele 4: CGGTCACACACACACACACACACACACACAGGTCAATG
• Genetic maps


  The frequency of genetic recombination between two loci on the same chromosome reveals their genetic distance.
• Loci A and B segregate independently


  Loci A and B tend to segregate together
• Linkage analysis


  Studies the distribution of alleles in pedigrees. The sequence of alleles on a chromosome (haplotypes) tells us recombination events between two loci.
• Segregation analysis


  The segregation of two loci can be either recombinant (R) or non-recombinant (N), i.e. offspring has received either recombinant or non-recombinant germ cells.
• Recombination rate


  Measure of how often genetic material is exchanged between chromosomes during meiosis
• Genetic maps


  Representation of the relative positions of genetic markers along a chromosome
• Linkage analysis


  Studies the distribution of alleles in pedigrees to identify recombination events between two loci
• Haplotype


  The sequence of alleles on a chromosome
• Locus


  The specific location of a gene or DNA sequence on a chromosome
• Segregation analysis


  Examines the distribution of alleles in offspring to determine if loci are independent or linked
• Segregation patterns


  • Independent segregation (N:R = 5:5)
  • Linked loci, co-segregation (N:R = 9:1)
• Recombinant (R)


  Offspring has received recombinant germ cells
• Non-recombinant (N)


  Offspring has received non-recombinant germ cells
• Knowing whether meioses are "phase-known" or "phase-unknown" is important for linkage analysis
• Phasing pedigrees


  Determining if a sperm is recombinant or non-recombinant between a condition locus and a marker locus
• Assigning N and R to pedigrees


  Deducing recombination events and determining if an association between a mutation and marker allele can be defined